Characterization of a broad-spectrum antifungal strain, Streptomyces graminearus STR-1, against Magnaporthe oryzae.

Fungal diseases such as the devastating rice blast pose severe threats to crop production worldwide. Biological control of crop diseases caused by fungal pathogens is an environment-friendly approach for safeguarding crop production. But the insufficient availability of microbial agents effective against various fungal diseases has hampered the development of green production in crops. In this study, we identified a broad-spectrum antifungal bacterium, Streptomyces graminearus STR-1, showing antagonistic activity to diverse fungal pathogens including Magnaporthe oryzae, Rhizoctonia solani, Fusarium graminearum, Ustilaginoidea virens, and Bipolaris maydis. Its antifungal activity was relatively stable and less affected by temperature and pH. Evaluation of the biocontrol activity of STR-1 revealed that STR-1 prevented and controlled rice blast disease via eliciting plant immunity and suppressing fungal infection-structure development. STR-1 broth extract inhibited spore germination, likely through inhibiting protein synthesis. Combining LC-MS and chromatography analysis of the antimicrobial compounds purified from STR-1 broth extract, together with decoding STR-1 genomic sequence, we identified 4-oxo-4-[(1-phenylethyl)amino]but-2-enoic acid, 1,3,5-Trimethylpyrazole and SMA-1 as the potential main STR-1 secondary metabolites associated with its antifungal effects. This study suggests that bacterial strain STR-1 could be used for identifying highly effective and broad-spectrum secondary metabolites for containing rice blast and other crop diseases. The application of the active compounds offers a promising measure to tackle fungal disease.

[Ozone Pollution in Suzhou During Early Summertime: Formation Mechanism and Interannual Variation].

This study investigated the concentrations of atmospheric pollutants in the urban area of Suzhou from May to June, 2017-2021. The variation characteristics and annual changes of ozone (O3), nitrogen oxide (NOx), total oxidant (Ox), carbon monoxide (CO), and volatile organic compounds (VOCs) were analyzed. The O3 formation mechanism and its annual changes were studied using an Observation-Based Model (OBM), and VOCs source apportionments and their trends were discussed. The results indicated that ① The volume fractions of Ox and the concentrations of NOx and CO have decreased in the urban area of Suzhou in recent years, while the volume fractions of VOCs have increased, and sufficient photochemical conditions for O3 formation still existed during polluted days. ② The O3-NOx-VOCs sensitivity in Suzhou was in the VOCs-limited regime. The long-term reduction ratio between VOCs and NOx should not be less than 5:1, and aromatics and alkenes were the critical VOCs for mitigating O3 pollution. ③ The results of VOCs source apportionment revealed that industrial emissions, gasoline vehicle exhaust, and diesel engine exhaust were the major sources of VOC emissions in Suzhou. Industrial emissions and solvent usage declined from 2017 to 2021; however, gasoline vehicle exhaust and gasoline evaporation, which possess higher O3 formation potential(OFP), increased significantly. ④ The OFP source apportionments results indicated that controlling VOC emissions from solvent usage and gasoline vehicle exhaust is crucial for O3 pollution control in Suzhou.

Celastrol inhibits oligodendrocyte and neuron ferroptosis to promote spinal cord injury recovery.

BACKGROUND: Spinal cord injury (SCI) is a traumatic injury to the central nervous system and can cause lipid peroxidation in the spinal cord. Ferroptosis, an iron-dependent programmed cell death, plays a key role in the pathophysiology progression of SCI. Celastrol, a widely used antioxidant drug, has potential therapeutic value for nervous system. PURPOSE: To investigate whether celastrol can be a reliable candidate for ferroptosis inhibitor and the molecular mechanism of celastrol in repairing SCI by inhibiting ferroptosis. METHODS: First, a rat SCI model was constructed, and the recovery of motor function was observed after treatment with celastrol. The regulatory effect of celastrol on ferroptosis pathway Nrf2-xCT-GPX4 was detected by Western blot and immunofluorescence. Finally, the ferroptosis model of neurons and oligodendrocytes was constructed in vitro to further verify the mechanism of inhibiting ferroptosis by celastrol. RESULTS: Our results demonstrated that celastrol promoted the recovery of spinal cord tissue and motor function in SCI rats. Further in vitro and in vivo studies showed that celastrol significantly inhibited ferroptosis in neurons and oligodendrocytes and reduced the accumulation of ROS. Finally, we found that celastrol could inhibit ferroptosis by up-regulating the Nrf2-xCT-GPX4 axis to repair SCI. CONCLUSION: Celastrol effectively inhibits ferroptosis after SCI by upregulating the Nrf2-xCT-GPX4 axis, reducing the production of lipid ROS, protecting the survival of neurons and oligodendrocytes, and improving the functional recovery.

Exploration of the effect and potential mechanism of quercetin in repairing spinal cord injury based on network pharmacology and in vivo experimental verification.

Spinal cord injury (SCI) is a highly complex neurological disease, but there is no effective repair method. Quercetin is a flavonol drug and has a variety of biological activities, such as scavenging oxygen free radicals in the body to resist oxidation, inhibiting inflammation, and so on. In this study, quercetin was firstly demonstrated to reduce tissue damage, promote neuron survival and repair motor function after SCI in rats through in vivo experiments. Then, 293 potential targets of quercetin repair for SCI were predicted by network pharmacology. GO analysis revealed that the biological processes of potential targets focused mainly on signal transduction, negative regulation of the apoptotic process, protein phosphorylation, drug response, and so on. Similarly, KEGG analysis suggested that these potential targets were involved in cell growth regulation, differentiation, apoptosis, and a few metabolic pathways. PPI network analysis predicted that the key genes were EP300, CREBBP, SRC, HSP90AA1, TP53, PIK3R1, EGFR, ESR1, and CBL. Further, the molecular docking showed that quercetin binds well with these proteins. Finally, RT-qPCR and Western blotting experiments verified that quercetin downregulated the expression levels of PIK3R1 and EGFR. It is suggested that quercetin can repair SCI in rats through PI3K-AKT signaling pathway and EGFR/MAPK pathway, which may provide a new theoretical basis for the repair of spinal cord injury.

High titer (>200 g/L) lactic acid production from undetoxified pretreated corn stover.

Lignocellulosic biomass is a reliable feedstock for lactic acid fermentation, low product titers hamper the scale production of cellulosic lactic acid. In this study, a Densifying Lignocellulosic biomass with Chemicals (sulfuric acid) pretreatment based cellulosic lactic acid biorefinery system was developed and demonstrated from multi-dimensions of producing bacteria, fermentation modes, corn stover solid loadings, fermentation vessels, and product purification. Results suggested that several lactic acid bacteria exhibited high fermentation activity in high solid loading corn stover hydrolysates. Remarkably, simultaneous saccharification co-fermentation performed in 100-mL flasks enabled 210.1 g/L lactic acid from 40% solid loading corn stover hydrolysate. When simultaneous saccharification co-fermentation was performed in 3-L bioreactors, 157.4 g/L lactic acid was obtained from 35% solid loading corn stover hydrolysate. These obtained lactic acid titers are the highest reports until now when lignocellulosic biomasses are used as substrates, making it efficient for scale production of cellulosic lactic acid.

The discovery of the new mechanism: Celastrol improves spinal cord injury by increasing cAMP through VIP-ADCYAP1R1-GNAS pathway.

Spinal cord injury (SCI) is a debilitating condition that results in significant impairment of motor function and sensation. Despite the ongoing efforts to develop effective treatments, there are currently very limited options available for patients with SCI. Celastrol, a natural anti-inflammatory compound extracted from Tripterygium wilfordii, has been shown to exhibit anti-inflammatory and anti-apoptotic properties. In this study, we aimed to explore the therapeutic potential of celastrol for SCI and elucidate the underlying molecular mechanisms involved. We found that local tissue often experiences a significant decrease in cAMP content and occurrs apoptosis after SCI. However, the treatment of celastrol could promote the production of cAMP by up-regulating the VIP-ADCYAP1R1-GNAS pathway. This could effectively inhibit the phosphorylation of JNK and prevent apoptosis, ultimately improving the exercise ability after SCI. Together, our results reveal celastrol may be a promising therapeutic agent for the treatment of SCI.

Research progress on the bulb expansion and starch enrichment in taro (Colocasia esculenta (L). Schott).

Background: Taro is an important potato crop, which can be used as food, vegetable, feed, and industrial raw material. The yield and quality of taro are primarily determined by the expansion degree of taro bulb and the filling condition of starch, whereas the expansion of taro bulb is a complex biological process. However, little information is reviewed on the research progress of bulb expansion and starch enrichment in taro. Methodology: PubMed, Web of Science, and the China National Knowledge Infrastructure databases were searched for relevant articles. After removing duplicate articles and articles with little relevance, 73 articles were selected for review. Results: This article introduces the formation and development of taro bulb for workers engaged in taro research. The content includes the process of amyloplast formation at the cytological level and changes in bulb expansion and starch enrichment at physiological levels, which involve endogenous hormones and key enzyme genes for starch synthesis. The effects of environment and cultivation methods on taro bulb expansion were also reviewed. Conclusions: Future research directions and research focus about the development of taro bulb were proposed. Limited research has been conducted on the physiological mechanism and hormone regulatory pathway of taro growth and development, taro bulb expansion, key gene expression, and starch enrichment. Therefore, the abovementioned research will become the key research direction in the future.

Xiao Chai Hu Tang alleviates the pancreatic tumorigenesis via improving the mtDNA N6-Methyladenine modification mediated mitochondrial dysfunction in Syrian hamster model.

BACKGROUND: Pancreatic intraepithelial neoplasia (PanIN) is the most common precursor lesion of pancreatic ductal adenocarcinoma (PDAC), which is a highly malignant tumor and lack of effective treatment. Although Xiao Chai Hu Tang (XCHT) has a good therapeutic effect on pancreatic cancer patients with advanced stage, the effect and mechanism of XCHT remains unclear in pancreatic tumorigenesis. PURPOSE: To assess the therapeutic effects of XCHT on the malignant transformation from PanIN to PDAC and to reveal its mechanisms of pancreatic tumorigenesis. METHODS: Syrian golden hamster were induced by N-Nitrosobis (2-oxopropyl) amine (BOP) to establish the pancreatic tumorigenesis model. The morphological changes of pancreatic tissue were observed by H&E and Masson staining; the Gene ontology (GO) analysis the transcriptional profiling changes; the mitochondrial ATP generation, mitochondrial redox status, mitochondrial DNA (mtDNA) N6-methyladenine (6mA) level and relative mtDNA genes expressions were examined. In addition, immunofluorescence detect the cell localization of 6mA in human pancreatic cancer PANC1 cell. Using the TCGA database, the prognostic effect of mtDNA 6mA demethylation ALKBH1 expression on pancreatic cancer patients was analyzed. RESULTS: We confirmed the mtDNA 6mA levels were gradually increased with the mitochondrial dysfunction in PanINs progression. XCHT showed the effect to inhibit the occurrence and development of pancreatic cancer in Syrian hamster pancreatic tumorigenesis model. In addition, the lack of ALKBH1 mediated mtDNA 6mA increase, mtDNA coded genes down-expression and abnormal redox status were rescued by XCHT. CONCLUSIONS: ALKBH1/mtDNA 6mA mediated mitochondrial dysfunction to induce the occurrence and progression of pancreatic cancer. XCHT can improve ALKBH1 expression and mtDNA 6mA level, regulate the oxidative stress and expression of mtDNA coded genes. This study investigated a new molecular mechanism of pancreatic tumorigenesis, and revealed the therapeutic efficacy of XCHT in pancreatic tumorigenesis for the first time.

Spastin is required for human immunodeficiency virus-1 efficient replication through cooperation with the endosomal sorting complex required for transport (ESCRT) protein.

Human immunodeficiency virus-1 (HIV-1) encodes simply 15 proteins and thus depends on multiple host cellular factors for virus reproduction. Spastin, a microtubule severing protein, is an identified HIV-1 dependency factor, but the mechanism regulating HIV-1 is unclear. Here, the study showed that knockdown of spastin inhibited the production of the intracellular HIV-1 Gag protein and new virions through enhancing Gag lysosomal degradation. Further investigation showed that increased sodium tolerance 1 (IST1), the subunit of endosomal sorting complex required for transport (ESCRT), could interact with the MIT domain of spastin to regulate the intracellular Gag production. In summary, spastin is required for HIV-1 replication, while spastin-IST1 interaction facilitates virus production by regulating HIV-1 Gag intracellular trafficking and degradation. Spastin may serve as new target for HIV-1 prophylactic and therapy.

Autologous exosome facilitates load and target delivery of bioactive peptides to repair spinal cord injury.

Spinal cord injury (SCI) causes motor, sensory and automatic impairment due to rarely axon regeneration. Developing effective treatment for SCI in the clinic is extremely challenging because of the restrictive axonal regenerative ability and disconnection of neural elements after injury, as well as the limited systemic drug delivery efficiency caused by blood spinal cord barrier. To develop an effective non-invasive treatment strategy for SCI in clinic, we generated an autologous plasma exosome (AP-EXO) based biological scaffold where AP-EXO was loaded with neuron targeting peptide (RVG) and growth-facilitating peptides (ILP and ISP). This scaffold can be targeted delivered to neurons in the injured area and elicit robust axon regrowth across the lesion core to the levels over 30-fold greater than naïve treatment, thus reestablish the intraspinal circuits and promote motor functional recovery after spinal cord injury in mice. More importantly, in ex vivo, human plasma exosomes (HP-EXO) loaded with combinatory peptides of RVG, ILP and ISP showed safety and no liver and kidney toxicity in the application to nude SCI mice. Combining the efficacy and safety, the AP-EXO-based personalized treatment confers functional recovery after SCI and showed immense promising in biomedical applications in treating SCI. It is helpful to expand the application of combinatory peptides and human plasma derived autologous exosomes in promoting regeneration and recovery upon SCI treatment.

Identification of Differentially Expressed Proteins in Rats with Early Subacute Spinal Cord Injury using an iTRAQ-based Quantitative Analysis.

BACKGROUND: Injuries to the central nervous system (CNS), such as spinal cord injury (SCI), may devastate families and society. Subacute SCI may majorly impact secondary damage during the transitional period between the acute and subacute phases. A range of CNS illnesses has been linked to changes in the level of protein expression. However, the importance of proteins during the early subacute stage of SCI remains unknown. The role of proteins in the early subacute phase of SCI has not been established yet. METHODS: SCI-induced damage in rats was studied using isobaric tagging for relative and absolute protein quantification (iTRAQ) to identify proteins that differed in expression 3 days after the injury, as well as proteins that did not alter in expression. Differentially expressed proteins (DEPs) were analyzed employing Gene Ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis to discover the biological processes, cell components, and molecular functions of the proteins. We also performed Gene Set Enrichment Analysis (GSEA) software BP pathway and KEGG analysis on all proteins to further identify their functions. In addition, the first 15 key nodes of a protein-protein interaction (PPI) system were found. RESULTS: During the early subacute stage of SCI, we identified 176 DEPs in total between the control and damage groups, with 114 (64.77%) being up-regulated and 62 (35.23%) being downregulated. As a result of this study, we discovered the most important cellular components and molecular activities, as well as biological processes and pathways, in the early subacute phase of SCI. The top 15 high-degree core nodes were Alb, Plg, F2, Serpina1, Fgg, Apoa1, Vim, Hpx, Apoe, Agt, Ambp, Pcna, Gc, F12, and Gfap. CONCLUSION: Our study could provide new views on regulating the pathogenesis of proteins in the early subacute phase after SCI, which provides a theoretical basis for exploring more effective therapeutic targets for SCI in the future.

Bioinformatics analysis of ferroptosis in spinal cord injury.

Ferroptosis plays a key role in aggravating the progression of spinal cord injury (SCI), but the specific mechanism remains unknown. In this study, we constructed a rat model of T10 SCI using a modified Allen method. We identified 48, 44, and 27 ferroptosis genes that were differentially expressed at 1, 3, and 7 days after SCI induction. Compared with the sham group and other SCI subgroups, the subgroup at 1 day after SCI showed increased expression of the ferroptosis marker acyl-CoA synthetase long-chain family member 4 and the oxidative stress marker malondialdehyde in the injured spinal cord while glutathione in the injured spinal cord was lower. These findings with our bioinformatics results suggested that 1 day after SCI was the important period of ferroptosis progression. Bioinformatics analysis identified the following top ten hub ferroptosis genes in the subgroup at 1 day after SCI: STAT3, JUN, TLR4, ATF3, HMOX1, MAPK1, MAPK9, PTGS2, VEGFA, and RELA. Real-time polymerase chain reaction on rat spinal cord tissue confirmed that STAT3, JUN, TLR4, ATF3, HMOX1, PTGS2, and RELA mRNA levels were up-regulated and VEGFA, MAPK1 and MAPK9 mRNA levels were down-regulated. Ten potential compounds were predicted using the DSigDB database as potential drugs or molecules targeting ferroptosis to repair SCI. We also constructed a ferroptosis-related mRNA-miRNA-lncRNA network in SCI that included 66 lncRNAs, 10 miRNAs, and 12 genes. Our results help further the understanding of the mechanism underlying ferroptosis in SCI.

CREB1 Facilitates GABAergic Neural Differentiation of Human Mesenchymal Stem Cells through BRN2 for Pain Alleviation and Locomotion Recovery after Spinal Cord Injury.

The transplantation of GABAergic neuron cells has been reported to alleviate nerve pain and improve motor function after spinal cord injury (SCI). However, human mesenchymal stem cell (hMSC) differentiation into GABAergic neuron cells in a sufficient quantity remains to be accomplished. From a database screening, cAMP-responsive element-binding protein 1 (CREB1) was chosen as a potential modulator due to its critical role in the protein-protein interaction of genes related to GABAergic neural differentiation. Here, CREB1 was overexpressed in transfected hMSCs, where CREB1 could induce differentiation into GABAergic neuron cells with an upregulation of Map2 and GAD1 by 2- and 3.4-fold, respectively. Additionally, GABAergic neural differentiation was enhanced, while Notch signaling was inhibited, and BRN2 transcriptional activation played an important role in neuronal maturation. Moreover, transfected hMSCs injected into immunocompromised mice caused by CsA exhibited the neuronal markers Tuj1 and Map2 via the intraspinal route, suggesting an improvement in survival and neural differentiation. Significantly, improvement in both BMS scores (6.2 ± 1.30 vs. 4 ± 0) and thermal hyperalgesia latency (7.74 ± 2.36 s vs. 4.52 ± 0.39 s) was seen compared with the SCI naïve treatment at 4 weeks post-transplantation. Our study demonstrates that CREB1 is crucial in generating induced GABAergic neuron cells (iGNs) originating from hMSCs. Transplanting iGNs to injured spinal cord provides a promising strategy for alleviating neuropathic pain and locomotion recovery after SCI.

Delayed administration of nafamostat mesylate inhibits thrombin-mediated blood-spinal cord barrier breakdown during acute spinal cord injury in rats.

BACKGROUND: Nafamostat mesylate (nafamostat, NM) is an FDA-approved serine protease inhibitor that exerts anti-neuroinflammation and neuroprotective effects following rat spinal cord injury (SCI). However, clinical translation of nafamostat has been limited by an unclear administration time window and mechanism of action. METHODS: Time to first dose of nafamostat administration was tested on rats after contusive SCI. The optimal time window of nafamostat was screened by evaluating hindlimb locomotion and electrophysiology. As nafamostat is a serine protease inhibitor known to target thrombin, we used argatroban (Arg), a thrombin-specific inhibitor, as a positive control in the time window experiments. Western blot and immunofluorescence of thrombin expression level and its enzymatic activity were assayed at different time points, as well its receptor, the protease activated receptor 1 (PAR1) and downstream protein matrix metalloproteinase-9 (MMP9). Blood-spinal cord barrier (BSCB) permeability leakage indicator Evans Blue and fibrinogen were analyzed along these time points. The infiltration of peripheral inflammatory cell was observed by immunofluorescence. RESULTS: The optimal administration time window of nafamostat was 2-12 h post-injury. Argatroban, the thrombin-specific inhibitor, had a similar pattern. Thrombin expression peaked at 12 h and returned to normal level at 7 days post-SCI. PAR1, the thrombin receptor, and MMP9 were significantly upregulated after SCI. The most significant increase of thrombin expression was detected in vascular endothelial cells (ECs). Nafamostat and argatroban significantly downregulated thrombin and MMP9 expression as well as thrombin activity in the spinal cord. Nafamostat inhibited thrombin enrichment in endothelial cells. Nafamostat administration at 2-12 h after SCI inhibited the leakage of Evans Blue in the epicenter and upregulated tight junction proteins (TJPs) expression. Nafamostat administration 8 h post-SCI effectively inhibited the infiltration of peripheral macrophages and neutrophils to the injury site. CONCLUSIONS: Our study provides preclinical information of nafamostat about the administration time window of 2-12 h post-injury in contusive SCI. We revealed that nafamostat functions through inhibiting the thrombin-mediated BSCB breakdown and subsequent peripheral immune cells infiltration.

Regulating DNA methylation could reduce neuronal ischemia response and apoptosis after ischemia-reperfusion injury.

BACKGROUND: Ischemia-reperfusion injury (IRI) is an important pathophysiological condition that can cause cell injury and large-scale tissue injury in the nervous system. Previous studies have shown that epigenetic regulation may play a role in the pathogenesis of IRI. METHODS: In this study, we isolated mouse cortical neurons and constructed an oxygen-glucose deprivation/reoxygenation (OGD) model to explore the change in DNA methylation and its effect on the expression of corresponding genes. RESULTS: We found that DNA methylation in neurons increased with hypoxia duration and that hypermethylation of numerous promoters and 3'-untranslated regions increased. We performed Gene Ontology enrichment analysis to study gene function and Kyoto Encyclopedia of Genes and Genomes pathway analysis to identify the pathways associated with gene regulation. The results showed that hypermethylation-related genes expressed after OGD were related to physiological pathways such as neuronal projection, ion transport, growth and development, while hypomethylation-related genes were related to pathological pathways such as the external apoptosis signaling pathway, neuronal death regulation, and regulation of oxidative stress. However, the changes in DNA methylation were specific for certain genes and may have been related to OGD-induced neuronal damage. Importantly, we integrated transcription and DNA methylation data to identify several candidate target genes, including hypomethylated Apoe, Pax6, Bmp4, and Ptch1 and hypermethylated Adora2a, Crhr1, Stxbp1, and Tac1. This study further indicated the effect of DNA methylation on gene function in brain IRI from the perspective of epigenetics, and the identified genes may become new targets for achieving neuroprotection in the brain after IRI.

Identification of key genes involved in recovery from spinal cord injury in adult zebrafish.

Zebrafish are an effective vertebrate model to study the mechanisms underlying recovery after spinal cord injury. The subacute phase after spinal cord injury is critical to the recovery of neurological function, which involves tissue bridging and axon regeneration. In this study, we found that zebrafish spontaneously recovered 44% of their swimming ability within the subacute phase (2 weeks) after spinal cord injury. During this period, we identified 7762 differentially expressed genes in spinal cord tissue: 2950 were up-regulated and 4812 were down-regulated. These differentially expressed genes were primarily concentrated in the biological processes of the respiratory chain, axon regeneration, and cell-component morphogenesis. The genes were also mostly involved in the regulation of metabolic pathways, the cell cycle, and gene-regulation pathways. We verified the gene expression of two differentially expressed genes, clasp2 up-regulation and h1m down-regulation, in zebrafish spinal cord tissue in vitro. Pathway enrichment analysis revealed that up-regulated clasp2 functions similarly to microtubule-associated protein, which is responsible for axon extension regulated by microtubules. Down-regulated h1m controls endogenous stem cell differentiation after spinal cord injury. This study provides new candidate genes, clasp2 and h1m, as potential therapeutic intervention targets for spinal cord injury repair by neuroregeneration. All experimental procedures and protocols were approved by the Animal Ethics Committee of Tianjin Institute of Medical & Pharmaceutical Sciences (approval No. IMPS-EAEP-Q-2019-02) on September 24, 2019.

The relationship between characteristics of root morphology and grain filling in wheat under drought stress.

Drought is a common yield limiting factor in wheat production and has become a significant threat to global food security. Root system is the organ responsible for water uptake from soil and root growth is closely associated with yield and quality of wheat. However, the relationship between morphological and structural characteristics of root growth and caryopsis enrichment in wheat under drought stress is unclear. In this study, two wheat cultivars (YM13 and YN19) were treated with drought from flowering to caryopsis maturity stage. The changes in morphological structure of roots and characteristics of endosperm enrichment were investigated. Drought stress significantly reduced the root length, plant height, root dry weight and aboveground parts dry weight, whereas the root-shoot ratio of YM13 and YN19 increased by 17.65% and 8.33% under drought stress, respectively. The spike length, spike weight, grains number per spike and 1,000-grains weight of mature wheat also significantly declined under drought stress. Meanwhile, the cross section structure of roots was changed with the enlargement of vascular cylinder and dense distribution of xylem vessels under drought stress. Additionally, drought stress affected the substance enrichment in wheat caryopses, decreasing starch accumulation and increasing protein accumulation of endosperm. Correlation analysis suggested that the root length was closely correlated with the relative areas of amyloplast (0.51) and protein body (0.70), and drought stress increased the correlation coefficient (0.79 and 0.78, respectively). While the root dry weight had a significantly positive correlation with the plant height and aboveground parts dry weight. The results can provide theoretical basis for root architecture optimization, water-saving and high-yield cultivation and quality improvement in wheat.

Neurotropin exerts neuroprotective effects after spinal cord injury by inhibiting apoptosis and modulating cytokines.

BACKGROUND/OBJECTIVE: Spinal cord injury (SCI) severely and irreversibly damages the central nervous system. Neurotropin (NTP), a nonprotein extract obtained from inflamed rabbit skin inoculated with vaccinia virus, is a drug that has been used for more than sixty years to alleviate neuropathic pain. It also reportedly exerts a neuroprotective role in peripheral nerves and in response to various central nervous system diseases, such as brain injury and Alzheimer disease. However, whether NTP promotes SCI recovery remains unknown. This study evaluated NTP's effects after SCI and explored its underlying mechanisms in a rat contusion model of SCI. METHOD: NTP was intraperitoneally administered to adult female Wistar rats subjected to contusion-induced SCI. Functional recovery was evaluated with behavioural scores and electrophysiological examinations. Tissue recovery was assessed with magnetic resonance imaging as well as histological staining with haematoxylin and eosin and Luxol Fast Blue. Neuronal survival and gliosis were observed after NeuN and glial fibrillary acidic protein immunofluorescence. Levels of apoptosis were demonstrated with TdT-mediated dUTP nick-end labeling (TUNEL) staining, Caspase-3 and B-cell lymphoma-2 (Bcl-2) Western blot, and Annexin V/propidium iodide flow cytometry. A protein antibody chip analysis was performed to evaluate the expression levels of 67 rat cytokines. RESULTS: NTP treatment improved the hindlimb locomotor recovery of the injured animals as well as their electrophysiological outcomes after SCI. A dosage of 50 NTP units/kg was found to optimize the efficacy of NTP. Magnetic resonance imaging revealed that lesion sizes decreased after NTP treatment. The haematoxylin and eosin and Luxol Fast Blue staining showed significant increases in the amount of spared tissue. The NeuN and glial fibrillary acidic protein immunofluorescence revealed that NTP treatment increased neuronal survival and reduced gliosis in tissue samples obtained from the lesion's epicentre. That NTP inhibited apoptosis was confirmed by the decreased number of TUNEL-positive cells, level of Caspase-3 expression, and number of Annexin V/propidium iodide-positive cells, as well as the increased level of Bcl-2 expression. The protein array analysis identified 28 differentially expressed proteins in the NTP group, and the gene ontology (GO) analysis showed that the enriched differentially expressed proteins implicate janus kinase-signal transducer and activator of transcription (JAK-STAT) signalling pathways. The expression levels of proinflammatory cytokines such as interleukin 6, thymus chemokine-1(TCK-1), and lipopolysaccharide-induced CXC chemokine (LIX) decreased after NTP treatment, whereas the levels of prorepair cytokine hepatocyte growth factor and adiponectin increased. CONCLUSION: Our research provides evidence that NTP can improve functional outcomes and alleviate secondary injury after SCI by inhibiting apoptosis and modulating cytokines. THE TRANSLATIONAL POTENTIAL OF THIS ARTICLE: The multicomponent NTP might have broad target spectra in SCI pathophysiology and halt the secondary injury cascade. As a safe drug that features sixty years of clinical use as an analgesic, translating this demonstrated efficacy of NTP to addressing SCI in human patients may potentially be accelerated.

Neuroprotective effect of deferoxamine on erastininduced ferroptosis in primary cortical neurons.

The iron chelator deferoxamine has been shown to inhibit ferroptosis in spinal cord injury. However, it is unclear whether deferoxamine directly protects neurons from ferroptotic cell death. By comparing the survival rate and morphology of primary neurons and SH-SY5Y cells exposed to erastin, it was found that these cell types respond differentially to the duration and concentration of erastin treatment. Therefore, we studied the mechanisms of ferroptosis using primary cortical neurons from E16 mouse embryos. After treatment with 50 µM erastin for 48 hours, reactive oxygen species levels increased, and the expression of the cystine/glutamate antiporter system light chain and glutathione peroxidase 4 decreased. Pretreatment with deferoxamine for 12 hours inhibited these changes, reduced cell death, and ameliorated cellular morphology. Pretreatment with the apoptosis inhibitor Z-DEVD-FMK or the necroptosis inhibitor necrostain-1 for 12 hours did not protect against erastin-induced ferroptosis. Only deferoxamine protected the primary cortical neurons from ferroptosis induced by erastin, confirming the specificity of the in vitro ferroptosis model. This study was approved by the Animal Ethics Committee at the Institute of Radiation Medicine of the Chinese Academy of Medical Sciences, China (approval No. DWLL-20180913) on September 13, 2018.

Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus.

In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes.